top of page

Syngene gel doc software: Capture and analyze complex multiplex gels

litormaipalagri
Aug 20, 2023
4 min read


Syngene's unique software guarantee provides free updates of GeneTools and GeneSys for the life of the system. In order to provide you with the latest tools we constantly seek to improve and evolve our software utilising, where appropriate, the latest advances within the field of Molecular Biology.


We have recently removed the requirement for a licence on GeneTools. Installing this update will remove the licencing requirement from a previously installed version. You can install on as many PCs as you wish with the full installer. To obtain this installer, please contact support@syngene.com stating your requirement, including either the serial number of your instrument or a previous media key.




syngene gel doc software download



Please note: If you are running GeneSnap with the iChemi feature, or a ChemiGeniusQ camera or a ChemiGenius2 camera DO NOT upgrade to version 4.3.8, or greater, of GeneTools. The licensing for these features is no longer supported and they will stop working. If you have already performed the upgrade please contact support@syngene.com and we will attempt to resolve the issue.


GeneSnap from SynGene is a 3D Modeling, Converters, Presentation Tools, Screen Capture, and Viewers & Editors software that allows users to control hardware, capture images, and process the captured images. It provides features such as auto exposure, live image capture, single frame capture, and series of one or more images with identical or individually set exposures.


InGenius3 comes complete with unlimited copies of GeneTools image analysis software, enabling scientists to rapidly calculate molecular weight and DNA or protein quantity, as well as store or print high resolution and publication quality images on any computer, as and when they need to.


Gel electrophoresis was performed using 2% agarose gels, but the resolution between Z and W bands for the crow samples was very poor. To improve the band resolution, electrophoresis was repeated using 8% polyacrylamide gels, which were stained with ethidium bromide (Table 1). Images were acquired using a Syngene Gel Doc (G:Box, Syngene; Gene Sys software).


Additionally, the system features Labworks image acquisition and analysis software, a high-specification PC, and a darkroom enclosure that is user-friendly. The darkroom enclosure allows any camera to be mounted and many benchtop transilluminators to be installed inside. Gels, membranes, blots, and plates up to 25-cm by 26-cm can be visualized with five different transillumination wavelengths and three epi-illumination wavelengths.UVP, Inc., 2066 W. 11th St., Upland, CA 91786. Tel: 800-452-6788; Fax: 909-946-3597.


Tubular injury and glomerulosclerosis were scored based on PAS staining. For tubular injury, scoring was done by grading tubular injury, epithelial cell apoptosis, intra-luminal cast and brush border loss in 15 randomly chosen, non-overlapping fields (100 magnification). Glomerulosclerosis was scored based on histopathological finding of glomerulosclerosis in 20 randomly non-overlapped glomerulus (400 magnification). The lesions were graded on a scale from 0 to 4, i.e.: 0: normal; 1: the injury involved less than 25% of the field (for tubular injury) and glomerulus; 2: the injury involve 25 to 50%; 3: the injury involved 50 to 75%; and 4: extensive injury involving more than 75% [20]. Kidney fibrosis area fraction was quantified using ImageJ software in 15 randomly chosen, non-overlapping fields (400 magnification) for each sample.


Total RNA was extracted from kidney tissues using RNAiso PLUS (Takara Bio, Tokyo, Japan). RNA (1 μg) was reverse transcribed using ReverTra Ace Reverse Transcriptase (TOYOBO Co.,TRT-101) in a 20 μL reaction having random primer. Cycling conditions were 30 C for 10 min, 42 C for 60 min, and 99 C for 5 min. Complementary DNA was diluted 15 times, then used for RT-PCR. Real-time PCR (qRT-PCR) was performed to examine ppET-1 expression using Kappa SYBR Fast Master Mix 2 (KAPA Biosystem, KK4600) using Biorad qRT-PCR Machine (Biorad, CFX96) with duplicates for each sample. Reverse Transcription PCR (RT-PCR) was performed to examine expressions of Nephrin, Podocin, preproET-1 (ppET-1/ET-1 mRNA), Monocyte Chemoattractant Protein-1 (MCP-1), and Intercellular Adhesion Molecule-1 (ICAM-1). The level of ppET-1 expression was quantified to determine ET-1 level. The reaction mixture (1 μL) was then used as the template in a conventional PCR assay. GoTag Green Master Mix (Promega, M7122) was used. The initial denaturation was performed at temperature 94 C for 2 min. The condition for 30 cycles PCR were 94 C for 10 s, 60 C for 20 s, 72 C for 1 min, and the last extension was 72 C for 10 min. These following primer sets were used in this experiment: Nephrin: CCCAGGTACACAGAGCACAA (forward) and CTCACGCTCACAACCTTCAG (reverse), Podocin: GTGTCCAAAGCCATCCAGTT (forward) and GCAATGCTCTTCCTTTCCAG (reverse); ppET-1: CTGTGCACGCACCAGAGATG (forward) and AAGCATCAGTTGTGGCCTGTTAGA (reverse), Monocyte Chemoattractant Protein-1 (MCP-1): CTACAGACAACCACCTCAAGCACTTCTGTAG (forward) and GGCATCACAGTCCGAGTCACAC (reverse), Inter Cellular Adhesion Molecule-1 (ICAM-1): CAATTCACACTGAATGCCAGCTC (forward) and CAAGCAGTCCGTCTCGTCCA (reverse); and GAPDH: TTGCTGTTGAAGTCGCAGGAG (forward) and TGTGTCCGTCGTGGATCTGA (reverse). GAPDH expression was used for endogenous control. The PCR products were subjected to 2% agarose (Agarose S; Nippon Gene, Tokyo, Japan) gel electrophoresis and gel red staining (Bioron, Germany, Cat. No. 306009). The expression of PCR product in gel electrophoresis was quantified using densitometry analyses by imageJ software.


Cells were seeded onto 96-well tissue culture dishes at equal densities in six replicates. After attachment over-night, cells were transfected with MVI siRNA, or scrambled siRNA (Qiagen). Photomicrographs were taken every hour using an IncuCyte live-cell imager (Essen Biosciences, Ann Harbour, MI) and confluency of cultures was measured using IncuCyte software. Confluency values between wells were normalised to initial confluency for comparison. 2ff7e9595c


 
 
 

Recent Posts

See All

Comments


  • facebook icon
  • twitter icon
  • linkedin icon

©2023 by Lucia Maigret. Proudly created with Wix.com

bottom of page